restriction enzymes ehei (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
restriction enzymes ehei
Restriction Enzymes Ehei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5597 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/restriction+enzymes+ehei/NotI/pmc01262611-105-27-32
Average 99 stars, based on 5597 article reviews
Restriction Enzymes Ehei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5597 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/restriction+enzymes+ehei/NotI/pmc01262611-105-27-32
Average 99 stars, based on 5597 article reviews
restriction enzymes ehei - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Amplification:Article Title: Simian Virus 5 V Protein Acts as an Adaptor, Linking DDB1 to STAT2, To Facilitate the Ubiquitination of STAT1 Article Snippet: Recombinant baculovirus containing a gene for human DDB1 was made using the BAC-to-BAC Baculovirus Expression System (Invitrogen) following the manufacturer's protocols. .. Briefly, DDB1 was amplified by PCR from a preexisting clone using the following primers; Fwd: 5′AAATTTCCCGGGCGCCATGTCGTACAACTACGTGGTAACGG and Rev: 5′TTTTATGCGGCCGCTGCAGGTCG, and the resulting, amplified product was digested with Article Title: Simian Virus 5 V Protein Acts as an Adaptor, Linking DDB1 to STAT2, To Facilitate the Ubiquitination of STAT1 Article Snippet: Recombinant baculovirus containing a gene for human DDB1 was made using the BAC-to-BAC Baculovirus Expression System (Invitrogen) following the manufacturer’s protocols. .. Briefly, DDB1 was amplified by PCR from a preexisting clone using the following primers; Fwd: 5 AAATTTCCCGGGCGCCATG TCGTACAACTACGTGGTAACGG and Rev: 5 TTTTATGCGGCCGCTGC AGGTCG, and the resulting, amplified product was digested with Polymerase Chain Reaction:Article Title: Simian Virus 5 V Protein Acts as an Adaptor, Linking DDB1 to STAT2, To Facilitate the Ubiquitination of STAT1 Article Snippet: Recombinant baculovirus containing a gene for human DDB1 was made using the BAC-to-BAC Baculovirus Expression System (Invitrogen) following the manufacturer's protocols. .. Briefly, DDB1 was amplified by PCR from a preexisting clone using the following primers; Fwd: 5′AAATTTCCCGGGCGCCATGTCGTACAACTACGTGGTAACGG and Rev: 5′TTTTATGCGGCCGCTGCAGGTCG, and the resulting, amplified product was digested with Article Title: Simian Virus 5 V Protein Acts as an Adaptor, Linking DDB1 to STAT2, To Facilitate the Ubiquitination of STAT1 Article Snippet: Recombinant baculovirus containing a gene for human DDB1 was made using the BAC-to-BAC Baculovirus Expression System (Invitrogen) following the manufacturer’s protocols. .. Briefly, DDB1 was amplified by PCR from a preexisting clone using the following primers; Fwd: 5 AAATTTCCCGGGCGCCATG TCGTACAACTACGTGGTAACGG and Rev: 5 TTTTATGCGGCCGCTGC AGGTCG, and the resulting, amplified product was digested with Transformation Assay:Article Title: Simian Virus 5 V Protein Acts as an Adaptor, Linking DDB1 to STAT2, To Facilitate the Ubiquitination of STAT1 Article Snippet: Recombinant baculovirus containing a gene for human DDB1 was made using the BAC-to-BAC Baculovirus Expression System (Invitrogen) following the manufacturer's protocols. .. Briefly, DDB1 was amplified by PCR from a preexisting clone using the following primers; Fwd: 5′AAATTTCCCGGGCGCCATGTCGTACAACTACGTGGTAACGG and Rev: 5′TTTTATGCGGCCGCTGCAGGTCG, and the resulting, amplified product was digested with Article Title: Simian Virus 5 V Protein Acts as an Adaptor, Linking DDB1 to STAT2, To Facilitate the Ubiquitination of STAT1 Article Snippet: Recombinant baculovirus containing a gene for human DDB1 was made using the BAC-to-BAC Baculovirus Expression System (Invitrogen) following the manufacturer’s protocols. .. Briefly, DDB1 was amplified by PCR from a preexisting clone using the following primers; Fwd: 5 AAATTTCCCGGGCGCCATG TCGTACAACTACGTGGTAACGG and Rev: 5 TTTTATGCGGCCGCTGC AGGTCG, and the resulting, amplified product was digested with |
